Recombinant:Article Title: Collagenesis orchestrates mechanoadaptive development and homeostasis of intervertebral discs.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Acan Proteintech Cat# 13880-1-AP; RRID:AB_2722780 rabbit anti-TRPV4 Thermo Fisher Scientific Cat# PA5-41066; RRID:AB_2577216 rabbit anti-PIEZO1 Proteintech Cat# 15939-1-AP; RRID:AB_2231460 rabbit anti-Brachyury (T/TBXT) Abcam Cat# ab209665; RRID:AB_2750925 mouse anti-PROCR Abcam Cat# ab300523 mouse anti-Collagen II Abcam Cat# ab185430 rabbit anti-Collagen I ABclonal Cat# A24112 RRID:AB_3699218 rabbit anti-IL1 beta Novus Cat# NB600-633; RRID:AB_10001060 rabbit anti-MMP3 ABclonal Cat# A22328 rabbit anti-GPX3 Proteintech Cat# 13947-1-AP; RRID:AB_3085426 rabbit anti-RUNX1 Abcam Cat# ab92336, RRID:AB_2049267 IgG Proteintech Cat# 98136-1-RR; RRID:AB_3672282 Chemicals, peptides, and recombinant proteins EDTA Solarbio Cat# R1171 Peroxidase Blocking Buffer Beyotime Cat# P0100A Pepsin for retrieval ZSGB-BIO Cat# ZLI9013 Fetal Bovine Serum GIBCO Cat# 10091-148; LOT# 2535493P Bovine serum albumin Sigma-Aldrich Cat# B2064 Penicillin-Streptomycin Hyclone Cat# SV30010 Pronase Sigma-Aldrich Cat# P0652 Collagenase P Sigma-Aldrich Cat# 11213865001 Hyaluronidase Solarbio Cat# H8030 GSK1016790A MedChemExpress Cat# HY-19608 Yoda1 MedChemExpress Cat# HY-18723 SBE-β-CD MedChemExpress Cat# HY-17031 Critical commercial assays Picro-Sirius Red kit Solarbio Cat# G1472 Safranin-O/ Fast Green kit Solarbio Cat# G1371 Hematoxylin and eosin kit Sangon Cat# E607318 MGIEasy RNA toolkit MGI Cat# 1000006383 DNBelab C Series Single-Cell Library Prep Set MGI Cat# 940-001924-00 Deposited data Mouse coccygeal disc RNA-seq and scRNA-seq dataset This paper CRA037885 Mouse lumbar disc scRNA-seq dataset Zhang et al. 23 GSE235198 Human fetal disc scRNA-seq datasets This paper HRA009055 Human adolescent/childhood/adult disc scRNA-seq datasets Gan et al. 11 ; Cherif et al. 34 ; Wang et al. 36 GSE160756; HRA003747; GSE199866 Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Stock No: 000664 Mouse: C57BL/6N (Trpv4 -/- ) Cyagen Cat: S-KO-11372 (Continued on next page) Cell Reports 45, 117076, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primer: Trpv4 -/- Forward: GGAATGATGGTGATTTTGGCTAAC This paper N/A Primer: Trpv4 -/- Reverse: GGTGGCTATTTAGGGACATGGC This paper N/A Primer: Trpv4 +/+ Forward: CTACTTTGGTGAGTAGCGGTGGAG This paper N/A Primer: Trpv4 +/+ Reverse: GGTGGCTATTTAGGGACATGGC This paper N/A Software and algorithms ImageJ (v1.54d) National Institutes of Health RRID: SCR_003070 ParaVision (v6.0.1) Bruker RRID:SCR_001964 3-matic Medical (v17.0) Materialise N/A HyperMesh (Release 2022) Altair N/A Mimics (v25.0) Materialise RRID:SCR_012153 CTan (v1.20) Bruker RRID:SCR_021338 FCSnap (v1.1.21486) Olympus N/A OlyVIA (v3.4.1) Olympus RRID:SCR_016167 Nanoscope (v9.70) Bruker N/A Nanoscope Analysis (v3.00) Bruker N/A OMNIC (v9.2.86) Thermo Scientific N/A OMNIC Picta (v1.5) Thermo Scientific N/A STAR (v2.7.1) Dobin et al. 61 https://github.com/alexdobin/STAR DESeq2 (v1.34.0) Love et al. 62 https://github.com/thelovelab/DESeq2 clusterProfiler (v4.2.2) Wu et al. 63 https://github.com/YuLab-SMU/ clusterProfiler GSVA (v1.42.0) Hä nzelmann et al. 64 https://github.com/rcastelo/GSVA WGCNA (v1.72.1) Langfelder and Horvath 65 http://horvath.genetics.ucla.edu/html/ CoexpressionNetwork/Rpackages/ WGCNA/ DNBelab C Series HT single cell analysis (v1.2) MGI https://github.com/MGI-tech- bioinformatics/DNBelab_C_Series_HT_ scRNA-analysis-software Seurat (v4.3.0) Hao et al. 66 https://github.com/satijalab/seurat SCP (v0.5.4) N/A https://github.com/zhanghao-njmu/SCP QUBIC2 Xie et al. 67 https://github.com/OSU-BMBL/QUBIC2 COSG (v0.9.0) Dai et al. 68 https://github.com/genecell/COSG prospectr (v0.2.6) N/A https://github.com/l-ramirez-lopez/ prospectr R (v4.1.3) R Core Team https://www.r-project. org/RRID:SCR_001905 Rstudio Server (Build 485) Posit, PBC https://posit.co/RRID:SCR_000432 Other 7.0 T micro-MRI Bruker N/A micro-CT system (Skyscan 1272, 1276) Bruker N/A VS200 system Olympus RRID:SCR_024783
Blocking Assay:Article Title: Collagenesis orchestrates mechanoadaptive development and homeostasis of intervertebral discs.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Acan Proteintech Cat# 13880-1-AP; RRID:AB_2722780 rabbit anti-TRPV4 Thermo Fisher Scientific Cat# PA5-41066; RRID:AB_2577216 rabbit anti-PIEZO1 Proteintech Cat# 15939-1-AP; RRID:AB_2231460 rabbit anti-Brachyury (T/TBXT) Abcam Cat# ab209665; RRID:AB_2750925 mouse anti-PROCR Abcam Cat# ab300523 mouse anti-Collagen II Abcam Cat# ab185430 rabbit anti-Collagen I ABclonal Cat# A24112 RRID:AB_3699218 rabbit anti-IL1 beta Novus Cat# NB600-633; RRID:AB_10001060 rabbit anti-MMP3 ABclonal Cat# A22328 rabbit anti-GPX3 Proteintech Cat# 13947-1-AP; RRID:AB_3085426 rabbit anti-RUNX1 Abcam Cat# ab92336, RRID:AB_2049267 IgG Proteintech Cat# 98136-1-RR; RRID:AB_3672282 Chemicals, peptides, and recombinant proteins EDTA Solarbio Cat# R1171 Peroxidase Blocking Buffer Beyotime Cat# P0100A Pepsin for retrieval ZSGB-BIO Cat# ZLI9013 Fetal Bovine Serum GIBCO Cat# 10091-148; LOT# 2535493P Bovine serum albumin Sigma-Aldrich Cat# B2064 Penicillin-Streptomycin Hyclone Cat# SV30010 Pronase Sigma-Aldrich Cat# P0652 Collagenase P Sigma-Aldrich Cat# 11213865001 Hyaluronidase Solarbio Cat# H8030 GSK1016790A MedChemExpress Cat# HY-19608 Yoda1 MedChemExpress Cat# HY-18723 SBE-β-CD MedChemExpress Cat# HY-17031 Critical commercial assays Picro-Sirius Red kit Solarbio Cat# G1472 Safranin-O/ Fast Green kit Solarbio Cat# G1371 Hematoxylin and eosin kit Sangon Cat# E607318 MGIEasy RNA toolkit MGI Cat# 1000006383 DNBelab C Series Single-Cell Library Prep Set MGI Cat# 940-001924-00 Deposited data Mouse coccygeal disc RNA-seq and scRNA-seq dataset This paper CRA037885 Mouse lumbar disc scRNA-seq dataset Zhang et al. 23 GSE235198 Human fetal disc scRNA-seq datasets This paper HRA009055 Human adolescent/childhood/adult disc scRNA-seq datasets Gan et al. 11 ; Cherif et al. 34 ; Wang et al. 36 GSE160756; HRA003747; GSE199866 Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Stock No: 000664 Mouse: C57BL/6N (Trpv4 -/- ) Cyagen Cat: S-KO-11372 (Continued on next page) Cell Reports 45, 117076, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primer: Trpv4 -/- Forward: GGAATGATGGTGATTTTGGCTAAC This paper N/A Primer: Trpv4 -/- Reverse: GGTGGCTATTTAGGGACATGGC This paper N/A Primer: Trpv4 +/+ Forward: CTACTTTGGTGAGTAGCGGTGGAG This paper N/A Primer: Trpv4 +/+ Reverse: GGTGGCTATTTAGGGACATGGC This paper N/A Software and algorithms ImageJ (v1.54d) National Institutes of Health RRID: SCR_003070 ParaVision (v6.0.1) Bruker RRID:SCR_001964 3-matic Medical (v17.0) Materialise N/A HyperMesh (Release 2022) Altair N/A Mimics (v25.0) Materialise RRID:SCR_012153 CTan (v1.20) Bruker RRID:SCR_021338 FCSnap (v1.1.21486) Olympus N/A OlyVIA (v3.4.1) Olympus RRID:SCR_016167 Nanoscope (v9.70) Bruker N/A Nanoscope Analysis (v3.00) Bruker N/A OMNIC (v9.2.86) Thermo Scientific N/A OMNIC Picta (v1.5) Thermo Scientific N/A STAR (v2.7.1) Dobin et al. 61 https://github.com/alexdobin/STAR DESeq2 (v1.34.0) Love et al. 62 https://github.com/thelovelab/DESeq2 clusterProfiler (v4.2.2) Wu et al. 63 https://github.com/YuLab-SMU/ clusterProfiler GSVA (v1.42.0) Hä nzelmann et al. 64 https://github.com/rcastelo/GSVA WGCNA (v1.72.1) Langfelder and Horvath 65 http://horvath.genetics.ucla.edu/html/ CoexpressionNetwork/Rpackages/ WGCNA/ DNBelab C Series HT single cell analysis (v1.2) MGI https://github.com/MGI-tech- bioinformatics/DNBelab_C_Series_HT_ scRNA-analysis-software Seurat (v4.3.0) Hao et al. 66 https://github.com/satijalab/seurat SCP (v0.5.4) N/A https://github.com/zhanghao-njmu/SCP QUBIC2 Xie et al. 67 https://github.com/OSU-BMBL/QUBIC2 COSG (v0.9.0) Dai et al. 68 https://github.com/genecell/COSG prospectr (v0.2.6) N/A https://github.com/l-ramirez-lopez/ prospectr R (v4.1.3) R Core Team https://www.r-project. org/RRID:SCR_001905 Rstudio Server (Build 485) Posit, PBC https://posit.co/RRID:SCR_000432 Other 7.0 T micro-MRI Bruker N/A micro-CT system (Skyscan 1272, 1276) Bruker N/A VS200 system Olympus RRID:SCR_024783
Single Cell:Article Title: Collagenesis orchestrates mechanoadaptive development and homeostasis of intervertebral discs.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Acan Proteintech Cat# 13880-1-AP; RRID:AB_2722780 rabbit anti-TRPV4 Thermo Fisher Scientific Cat# PA5-41066; RRID:AB_2577216 rabbit anti-PIEZO1 Proteintech Cat# 15939-1-AP; RRID:AB_2231460 rabbit anti-Brachyury (T/TBXT) Abcam Cat# ab209665; RRID:AB_2750925 mouse anti-PROCR Abcam Cat# ab300523 mouse anti-Collagen II Abcam Cat# ab185430 rabbit anti-Collagen I ABclonal Cat# A24112 RRID:AB_3699218 rabbit anti-IL1 beta Novus Cat# NB600-633; RRID:AB_10001060 rabbit anti-MMP3 ABclonal Cat# A22328 rabbit anti-GPX3 Proteintech Cat# 13947-1-AP; RRID:AB_3085426 rabbit anti-RUNX1 Abcam Cat# ab92336, RRID:AB_2049267 IgG Proteintech Cat# 98136-1-RR; RRID:AB_3672282 Chemicals, peptides, and recombinant proteins EDTA Solarbio Cat# R1171 Peroxidase Blocking Buffer Beyotime Cat# P0100A Pepsin for retrieval ZSGB-BIO Cat# ZLI9013 Fetal Bovine Serum GIBCO Cat# 10091-148; LOT# 2535493P Bovine serum albumin Sigma-Aldrich Cat# B2064 Penicillin-Streptomycin Hyclone Cat# SV30010 Pronase Sigma-Aldrich Cat# P0652 Collagenase P Sigma-Aldrich Cat# 11213865001 Hyaluronidase Solarbio Cat# H8030 GSK1016790A MedChemExpress Cat# HY-19608 Yoda1 MedChemExpress Cat# HY-18723 SBE-β-CD MedChemExpress Cat# HY-17031 Critical commercial assays Picro-Sirius Red kit Solarbio Cat# G1472 Safranin-O/ Fast Green kit Solarbio Cat# G1371 Hematoxylin and eosin kit Sangon Cat# E607318 MGIEasy RNA toolkit MGI Cat# 1000006383 DNBelab C Series Single-Cell Library Prep Set MGI Cat# 940-001924-00 Deposited data Mouse coccygeal disc RNA-seq and scRNA-seq dataset This paper CRA037885 Mouse lumbar disc scRNA-seq dataset Zhang et al. 23 GSE235198 Human fetal disc scRNA-seq datasets This paper HRA009055 Human adolescent/childhood/adult disc scRNA-seq datasets Gan et al. 11 ; Cherif et al. 34 ; Wang et al. 36 GSE160756; HRA003747; GSE199866 Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Stock No: 000664 Mouse: C57BL/6N (Trpv4 -/- ) Cyagen Cat: S-KO-11372 (Continued on next page) Cell Reports 45, 117076, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primer: Trpv4 -/- Forward: GGAATGATGGTGATTTTGGCTAAC This paper N/A Primer: Trpv4 -/- Reverse: GGTGGCTATTTAGGGACATGGC This paper N/A Primer: Trpv4 +/+ Forward: CTACTTTGGTGAGTAGCGGTGGAG This paper N/A Primer: Trpv4 +/+ Reverse: GGTGGCTATTTAGGGACATGGC This paper N/A Software and algorithms ImageJ (v1.54d) National Institutes of Health RRID: SCR_003070 ParaVision (v6.0.1) Bruker RRID:SCR_001964 3-matic Medical (v17.0) Materialise N/A HyperMesh (Release 2022) Altair N/A Mimics (v25.0) Materialise RRID:SCR_012153 CTan (v1.20) Bruker RRID:SCR_021338 FCSnap (v1.1.21486) Olympus N/A OlyVIA (v3.4.1) Olympus RRID:SCR_016167 Nanoscope (v9.70) Bruker N/A Nanoscope Analysis (v3.00) Bruker N/A OMNIC (v9.2.86) Thermo Scientific N/A OMNIC Picta (v1.5) Thermo Scientific N/A STAR (v2.7.1) Dobin et al. 61 https://github.com/alexdobin/STAR DESeq2 (v1.34.0) Love et al. 62 https://github.com/thelovelab/DESeq2 clusterProfiler (v4.2.2) Wu et al. 63 https://github.com/YuLab-SMU/ clusterProfiler GSVA (v1.42.0) Hä nzelmann et al. 64 https://github.com/rcastelo/GSVA WGCNA (v1.72.1) Langfelder and Horvath 65 http://horvath.genetics.ucla.edu/html/ CoexpressionNetwork/Rpackages/ WGCNA/ DNBelab C Series HT single cell analysis (v1.2) MGI https://github.com/MGI-tech- bioinformatics/DNBelab_C_Series_HT_ scRNA-analysis-software Seurat (v4.3.0) Hao et al. 66 https://github.com/satijalab/seurat SCP (v0.5.4) N/A https://github.com/zhanghao-njmu/SCP QUBIC2 Xie et al. 67 https://github.com/OSU-BMBL/QUBIC2 COSG (v0.9.0) Dai et al. 68 https://github.com/genecell/COSG prospectr (v0.2.6) N/A https://github.com/l-ramirez-lopez/ prospectr R (v4.1.3) R Core Team https://www.r-project. org/RRID:SCR_001905 Rstudio Server (Build 485) Posit, PBC https://posit.co/RRID:SCR_000432 Other 7.0 T micro-MRI Bruker N/A micro-CT system (Skyscan 1272, 1276) Bruker N/A VS200 system Olympus RRID:SCR_024783
RNA Sequencing:Article Title: Collagenesis orchestrates mechanoadaptive development and homeostasis of intervertebral discs.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies rabbit anti-Acan Proteintech Cat# 13880-1-AP; RRID:AB_2722780 rabbit anti-TRPV4 Thermo Fisher Scientific Cat# PA5-41066; RRID:AB_2577216 rabbit anti-PIEZO1 Proteintech Cat# 15939-1-AP; RRID:AB_2231460 rabbit anti-Brachyury (T/TBXT) Abcam Cat# ab209665; RRID:AB_2750925 mouse anti-PROCR Abcam Cat# ab300523 mouse anti-Collagen II Abcam Cat# ab185430 rabbit anti-Collagen I ABclonal Cat# A24112 RRID:AB_3699218 rabbit anti-IL1 beta Novus Cat# NB600-633; RRID:AB_10001060 rabbit anti-MMP3 ABclonal Cat# A22328 rabbit anti-GPX3 Proteintech Cat# 13947-1-AP; RRID:AB_3085426 rabbit anti-RUNX1 Abcam Cat# ab92336, RRID:AB_2049267 IgG Proteintech Cat# 98136-1-RR; RRID:AB_3672282 Chemicals, peptides, and recombinant proteins EDTA Solarbio Cat# R1171 Peroxidase Blocking Buffer Beyotime Cat# P0100A Pepsin for retrieval ZSGB-BIO Cat# ZLI9013 Fetal Bovine Serum GIBCO Cat# 10091-148; LOT# 2535493P Bovine serum albumin Sigma-Aldrich Cat# B2064 Penicillin-Streptomycin Hyclone Cat# SV30010 Pronase Sigma-Aldrich Cat# P0652 Collagenase P Sigma-Aldrich Cat# 11213865001 Hyaluronidase Solarbio Cat# H8030 GSK1016790A MedChemExpress Cat# HY-19608 Yoda1 MedChemExpress Cat# HY-18723 SBE-β-CD MedChemExpress Cat# HY-17031 Critical commercial assays Picro-Sirius Red kit Solarbio Cat# G1472 Safranin-O/ Fast Green kit Solarbio Cat# G1371 Hematoxylin and eosin kit Sangon Cat# E607318 MGIEasy RNA toolkit MGI Cat# 1000006383 DNBelab C Series Single-Cell Library Prep Set MGI Cat# 940-001924-00 Deposited data Mouse coccygeal disc RNA-seq and scRNA-seq dataset This paper CRA037885 Mouse lumbar disc scRNA-seq dataset Zhang et al. 23 GSE235198 Human fetal disc scRNA-seq datasets This paper HRA009055 Human adolescent/childhood/adult disc scRNA-seq datasets Gan et al. 11 ; Cherif et al. 34 ; Wang et al. 36 GSE160756; HRA003747; GSE199866 Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Stock No: 000664 Mouse: C57BL/6N (Trpv4 -/- ) Cyagen Cat: S-KO-11372 (Continued on next page) Cell Reports 45, 117076, March 24, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primer: Trpv4 -/- Forward: GGAATGATGGTGATTTTGGCTAAC This paper N/A Primer: Trpv4 -/- Reverse: GGTGGCTATTTAGGGACATGGC This paper N/A Primer: Trpv4 +/+ Forward: CTACTTTGGTGAGTAGCGGTGGAG This paper N/A Primer: Trpv4 +/+ Reverse: GGTGGCTATTTAGGGACATGGC This paper N/A Software and algorithms ImageJ (v1.54d) National Institutes of Health RRID: SCR_003070 ParaVision (v6.0.1) Bruker RRID:SCR_001964 3-matic Medical (v17.0) Materialise N/A HyperMesh (Release 2022) Altair N/A Mimics (v25.0) Materialise RRID:SCR_012153 CTan (v1.20) Bruker RRID:SCR_021338 FCSnap (v1.1.21486) Olympus N/A OlyVIA (v3.4.1) Olympus RRID:SCR_016167 Nanoscope (v9.70) Bruker N/A Nanoscope Analysis (v3.00) Bruker N/A OMNIC (v9.2.86) Thermo Scientific N/A OMNIC Picta (v1.5) Thermo Scientific N/A STAR (v2.7.1) Dobin et al. 61 https://github.com/alexdobin/STAR DESeq2 (v1.34.0) Love et al. 62 https://github.com/thelovelab/DESeq2 clusterProfiler (v4.2.2) Wu et al. 63 https://github.com/YuLab-SMU/ clusterProfiler GSVA (v1.42.0) Hä nzelmann et al. 64 https://github.com/rcastelo/GSVA WGCNA (v1.72.1) Langfelder and Horvath 65 http://horvath.genetics.ucla.edu/html/ CoexpressionNetwork/Rpackages/ WGCNA/ DNBelab C Series HT single cell analysis (v1.2) MGI https://github.com/MGI-tech- bioinformatics/DNBelab_C_Series_HT_ scRNA-analysis-software Seurat (v4.3.0) Hao et al. 66 https://github.com/satijalab/seurat SCP (v0.5.4) N/A https://github.com/zhanghao-njmu/SCP QUBIC2 Xie et al. 67 https://github.com/OSU-BMBL/QUBIC2 COSG (v0.9.0) Dai et al. 68 https://github.com/genecell/COSG prospectr (v0.2.6) N/A https://github.com/l-ramirez-lopez/ prospectr R (v4.1.3) R Core Team https://www.r-project. org/RRID:SCR_001905 Rstudio Server (Build 485) Posit, PBC https://posit.co/RRID:SCR_000432 Other 7.0 T micro-MRI Bruker N/A micro-CT system (Skyscan 1272, 1276) Bruker N/A VS200 system Olympus RRID:SCR_024783
|
Proteintech is a verified supplier 